Transcript: Human NR_003655.3

Homo sapiens RNA polymerase II subunit J4, pseudogene (POLR2J4), non-coding RNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
POLR2J4 (84820)
Length:
6531
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003655.3
NBCI Gene record:
POLR2J4 (84820)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053029 CACTGGGAAACATCATTAAAT pLKO.1 203 3UTR 100% 15.000 7.500 Y POLR2J2 n/a
2 TRCN0000021869 CGAGAAGAAGATCACCATTAA pLKO.1 126 3UTR 100% 13.200 6.600 Y POLR2J n/a
3 TRCN0000337352 TGAAGTTCCTGGTGATGAATG pLKO_005 865 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
4 TRCN0000426974 TGCTATTTGCTGGCTACAAAG pLKO_005 251 3UTR 100% 10.800 5.400 Y POLR2J2 n/a
5 TRCN0000295830 GCCTTACAAGGGACACCATAG pLKO_005 1080 3UTR 100% 6.000 3.000 Y RASA4 n/a
6 TRCN0000063701 CGCTGGAATGAGACGTTTGAA pLKO.1 1270 3UTR 100% 5.625 2.813 Y RASA4 n/a
7 TRCN0000419248 AGTTCAGCAGCCACAACATCT pLKO_005 589 3UTR 100% 4.950 2.475 Y POLR2J2 n/a
8 TRCN0000428441 CCCTTGGAGCACAAGATCATC pLKO_005 280 3UTR 100% 4.950 2.475 Y POLR2J2 n/a
9 TRCN0000021873 CTGTTTATTCACCATCAACAA pLKO.1 171 3UTR 100% 4.950 2.475 Y POLR2J n/a
10 TRCN0000152711 CTTGGAGCACAAGATCATCAT pLKO.1 282 3UTR 100% 4.950 2.475 Y POLR2J3 n/a
11 TRCN0000151471 CAATGCCTGTTTATTCACCAT pLKO.1 165 3UTR 100% 2.640 1.320 Y POLR2J3 n/a
12 TRCN0000053030 CACCATTAACAAGGACACCAA pLKO.1 138 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
13 TRCN0000153197 CCAATGCCTGTTTATTCACCA pLKO.1 164 3UTR 100% 2.640 1.320 Y POLR2J3 n/a
14 TRCN0000053032 CCATCAACAAAGAAGACCACA pLKO.1 182 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
15 TRCN0000053031 CCGTGATTGTCAGTTTCCTGA pLKO.1 430 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
16 TRCN0000174239 CCGTGATTGTCAGTTTCCTGA pLKO.1 430 3UTR 100% 2.640 1.320 Y POLR2J2 n/a
17 TRCN0000150598 GAAGATCACCATTAACAAGGA pLKO.1 132 3UTR 100% 2.640 1.320 Y POLR2J3 n/a
18 TRCN0000021870 GCAAGTGCTATTTGCTGGCTA pLKO.1 246 3UTR 100% 2.640 1.320 Y POLR2J n/a
19 TRCN0000295831 TCCACGCTGTGGCTTTCTATG pLKO_005 1011 3UTR 100% 10.800 5.400 Y RASA4 n/a
20 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5567 3UTR 100% 5.625 2.813 Y KLHL30 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5567 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01243 pDONR223 100% 5% None (many diffs) n/a
2 ccsbBroad304_01243 pLX_304 0% 5% V5 (many diffs) n/a
3 TRCN0000474650 ACAATCGTGAGTCTTCATTCAACT pLX_317 94.6% 5% V5 (many diffs) n/a
Download CSV