Transcript: Human NR_003674.2

Homo sapiens fibroblast growth factor 7 pseudogene 6 (FGF7P6), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FGF7P6 (387628)
Length:
2115
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003674.2
NBCI Gene record:
FGF7P6 (387628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163571 GCAGCTAAATGGACACACAAT pLKO.1 729 3UTR 100% 4.950 2.970 N FGF7P6 n/a
2 TRCN0000159283 GCAAAGAAAGAATGCAATGAA pLKO.1 657 3UTR 100% 5.625 2.813 Y FGF7P6 n/a
3 TRCN0000166271 CGGTTGGGACAAGTACAGTAA pLKO.1 373 3UTR 100% 4.950 2.475 Y FGF7P6 n/a
4 TRCN0000165655 GCTGGCAGGATTTGTCAGATA pLKO.1 1287 3UTR 100% 4.950 2.475 Y FGF7P6 n/a
5 TRCN0000163378 GTCTCAGCTTTCTCATCTGTA pLKO.1 352 3UTR 100% 4.950 2.475 Y FGF7P6 n/a
6 TRCN0000164145 CCACTTTCTTCCTATGGCAAT pLKO.1 830 3UTR 100% 4.050 2.025 Y FGF7P6 n/a
7 TRCN0000058454 CCCACTTTCTTCCTATGGCAA pLKO.1 829 3UTR 100% 2.640 1.320 Y FGF7 n/a
8 TRCN0000165198 GTTTGGGATCGAGATCTGGAA pLKO.1 113 3UTR 100% 2.640 1.320 Y FGF7P6 n/a
9 TRCN0000164723 CAGCTTTCTCATCTGTACGGT pLKO.1 356 3UTR 100% 0.750 0.375 Y FGF7P6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10364 pDONR223 100% 21.7% None 1_76del;536_2115del n/a
2 ccsbBroad304_10364 pLX_304 0% 21.7% V5 1_76del;536_2115del n/a
3 TRCN0000466871 ACAGCGAGTAGACGACGTGCACTT pLX_317 79.6% 21.7% V5 1_76del;536_2115del n/a
Download CSV