Transcript: Human NR_003683.2

Homo sapiens ALMS1 pseudogene 1 (ALMS1P1), non-coding RNA.

Source:
NCBI, updated 2019-01-21
Taxon:
Homo sapiens (human)
Gene:
ALMS1P1 (200420)
Length:
1608
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003683.2
NBCI Gene record:
ALMS1P1 (200420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139387 CAGGAGGAACAGTAGCACAAA pLKO.1 994 3UTR 100% 4.950 3.465 N ALMS1P1 n/a
2 TRCN0000122314 CCTGACTTCATCTCCCACATT pLKO.1 759 3UTR 100% 4.950 3.465 N ALMS1P1 n/a
3 TRCN0000140678 CTTCCAGGGAAAGGAGAGAAA pLKO.1 1047 3UTR 100% 4.950 3.465 N ALMS1P1 n/a
4 TRCN0000121624 GCAAGTTCGTAGAGACAGAAT pLKO.1 1264 3UTR 100% 4.950 3.465 N ALMS1P1 n/a
5 TRCN0000139243 CCACTGAAGCTGTTTGTGAGA pLKO.1 705 3UTR 100% 2.640 1.848 N ALMS1P1 n/a
6 TRCN0000140614 GCAGAGCATGTTAAAGAGCGA pLKO.1 827 3UTR 100% 0.660 0.462 N ALMS1P1 n/a
7 TRCN0000143916 CCACTGAACTGTACACGTTAA pLKO.1 1426 3UTR 100% 10.800 6.480 N ALMS1P1 n/a
8 TRCN0000143068 CGGATAAAGCGTCTGAAGTTA pLKO.1 786 3UTR 100% 5.625 3.375 N ALMS1P1 n/a
9 TRCN0000139695 CTGCAGGAATCGCTTCAGTTT pLKO.1 732 3UTR 100% 4.950 2.970 N ALMS1P1 n/a
10 TRCN0000140767 GCGGATAAAGCGTCTGAAGTT pLKO.1 785 3UTR 100% 4.950 2.970 N ALMS1P1 n/a
11 TRCN0000143223 GCCTATCAGCAAGAAGGAAAT pLKO.1 947 3UTR 100% 10.800 5.400 Y ALMS1P1 n/a
12 TRCN0000144740 GAAATGATTCAGAGGTCCAAA pLKO.1 963 3UTR 100% 4.950 2.475 Y ALMS1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10575 pDONR223 100% 38.9% None (many diffs) n/a
2 ccsbBroad304_10575 pLX_304 0% 38.9% V5 (many diffs) n/a
3 TRCN0000465840 ATATTCTCGCTCGCTTACTTGGGA pLX_317 64.3% 38.9% V5 (many diffs) n/a
Download CSV