Transcript: Human NR_003954.1

Homo sapiens katanin regulatory subunit B1 like 1 pseudogene 6 (KATNBL1P6), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
KATNBL1P6 (729176)
Length:
2156
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003954.1
NBCI Gene record:
KATNBL1P6 (729176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264496 CCAGGATATACTGGTAATATA pLKO_005 971 3UTR 100% 15.000 7.500 Y Katnbl1 n/a
2 TRCN0000338793 CCAGGATATACTGGTAATATA pLKO_005 971 3UTR 100% 15.000 7.500 Y KATNBL1 n/a
3 TRCN0000264498 TAAGGATGTAGATGCTTATTT pLKO_005 994 3UTR 100% 15.000 7.500 Y Katnbl1 n/a
4 TRCN0000338788 TCTAGTAAAGTCACTACTTAA pLKO_005 780 3UTR 100% 13.200 6.600 Y KATNBL1 n/a
5 TRCN0000159599 GTTCCAGGATATACTGGTAAT pLKO.1 968 3UTR 100% 10.800 5.400 Y KATNBL1 n/a
6 TRCN0000160272 CCAATTGTTTACAGGAAGAAA pLKO.1 719 3UTR 100% 5.625 2.813 Y KATNBL1 n/a
7 TRCN0000158775 GCTTATTTGTTGAGGATAGAA pLKO.1 661 3UTR 100% 5.625 2.813 Y KATNBL1 n/a
8 TRCN0000338717 GCTTATTTGTTGAGGATAGAA pLKO_005 661 3UTR 100% 5.625 2.813 Y KATNBL1 n/a
9 TRCN0000161750 CGTAAAGTGATCTATCGCAGA pLKO.1 312 3UTR 100% 2.160 1.080 Y KATNBL1 n/a
10 TRCN0000158861 GAGGATCATTTCATTGATCTT pLKO.1 167 3UTR 100% 0.495 0.248 Y KATNBL1 n/a
11 TRCN0000264497 AGTGAACTTGTAGCTTATTTA pLKO_005 649 3UTR 100% 15.000 7.500 Y Katnbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04123 pDONR223 100% 41.4% None (many diffs) n/a
Download CSV