Transcript: Mouse NR_003961.1

Mus musculus ankyrin repeat and SOCS box-containing 7 (Asb7), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Asb7 (117589)
Length:
5057
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003961.1
NBCI Gene record:
Asb7 (117589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241515 CACGGATGCTGTATAACTATG pLKO_005 1568 3UTR 100% 10.800 15.120 N Asb7 n/a
2 TRCN0000190032 GACACAAACTTAGGGCGTCTA pLKO.1 1492 3UTR 100% 4.050 5.670 N Asb7 n/a
3 TRCN0000241514 CAGGACCTGTGCCGAATTAAA pLKO_005 1714 3UTR 100% 15.000 12.000 N Asb7 n/a
4 TRCN0000241516 ATCCCACGGTTAAGGATTTAA pLKO_005 1094 3UTR 100% 15.000 10.500 N Asb7 n/a
5 TRCN0000241513 CCCACGCTTGAAGGTCTTAAT pLKO_005 2062 3UTR 100% 13.200 9.240 N Asb7 n/a
6 TRCN0000241517 GGTCATGAAAGACTACTTAAA pLKO_005 1794 3UTR 100% 13.200 9.240 N Asb7 n/a
7 TRCN0000217732 GTGGACAAGATTACGAGTTAT pLKO.1 1849 3UTR 100% 13.200 9.240 N Asb7 n/a
8 TRCN0000200532 CCATAAGTATTTCAGGAAGTA pLKO.1 1640 3UTR 100% 4.950 3.465 N Asb7 n/a
9 TRCN0000201637 CGCTCAGTGATAAAGGTACAA pLKO.1 1313 3UTR 100% 4.950 3.465 N Asb7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04935 pDONR223 100% 14.4% None (many diffs) n/a
2 ccsbBroad304_04935 pLX_304 0% 14.4% V5 (many diffs) n/a
3 TRCN0000469698 GCCTGTAATGGTGGACCAAATAAA pLX_317 50.7% 14.4% V5 (many diffs) n/a
Download CSV