Transcript: Mouse NR_004442.1

Mus musculus predicted gene 15421 (Gm15421), non-coding RNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm15421 (100042049)
Length:
810
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_004442.1
NBCI Gene record:
Gm15421 (100042049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_004442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247702 TTCTACGGGAGAAGGTTAAAG pLKO_005 451 3UTR 100% 13.200 6.600 Y RPL22L1 n/a
2 TRCN0000247703 CTTACCAAGAAATACCTTAAG pLKO_005 579 3UTR 100% 10.800 5.400 Y RPL22L1 n/a
3 TRCN0000104326 CACATTGAACGCCTGAAGAAT pLKO.1 507 3UTR 100% 5.625 2.813 Y Rpl22l1 n/a
4 TRCN0000104327 CGCATCTGACAAGGAGACTTA pLKO.1 632 3UTR 100% 4.950 2.475 Y Rpl22l1 n/a
5 TRCN0000354138 CGCATCTGACAAGGAGACTTA pLKO_005 632 3UTR 100% 4.950 2.475 Y Rpl22l1 n/a
6 TRCN0000104328 CGGGAGAAGGTTAAAGTCAAT pLKO.1 456 3UTR 100% 4.950 2.475 Y Rpl22l1 n/a
7 TRCN0000332386 CGGGAGAAGGTTAAAGTCAAT pLKO_005 456 3UTR 100% 4.950 2.475 Y Rpl22l1 n/a
8 TRCN0000186999 CTTACTCATCCAGTAGAAGAT pLKO.1 399 3UTR 100% 4.950 2.475 Y Gm4910 n/a
9 TRCN0000104329 AGGAGACTTACGAACTTCGTT pLKO.1 643 3UTR 100% 3.000 1.500 Y Rpl22l1 n/a
10 TRCN0000332314 AGGAGACTTACGAACTTCGTT pLKO_005 643 3UTR 100% 3.000 1.500 Y Rpl22l1 n/a
11 TRCN0000104325 TCTGAGAAACAGTTCTCCAAA pLKO.1 543 3UTR 100% 0.495 0.248 Y Rpl22l1 n/a
12 TRCN0000332385 TCTGAGAAACAGTTCTCCAAA pLKO_005 543 3UTR 100% 0.495 0.248 Y Rpl22l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_004442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09810 pDONR223 100% 41.8% None (many diffs) n/a
2 ccsbBroad304_09810 pLX_304 0% 41.8% V5 (many diffs) n/a
3 TRCN0000479663 GAAATAGAATTATTACTGATTTGA pLX_317 82.5% 41.8% V5 (many diffs) n/a
Download CSV