Transcript: Human NR_023916.1

Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 1 pseudogene 1 (PIN1P1), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
PIN1P1 (5301)
Length:
996
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023916.1
NBCI Gene record:
PIN1P1 (5301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049209 CCTGCTAGTGAAGCCAGTCAA pLKO.1 212 3UTR 100% 4.950 3.465 N PIN1P1 n/a
2 TRCN0000049210 CAAGGCAGGAGAGAAGGACTT pLKO.1 315 3UTR 100% 4.050 2.835 N PIN1P1 n/a
3 TRCN0000049212 AGGGTACTACTTCAACCACAT pLKO.1 98 3UTR 100% 4.050 2.430 N PIN1P1 n/a
4 TRCN0000049208 GCAGGAAATCACCCGGACCAA pLKO.1 252 3UTR 100% 0.880 0.528 N PIN1P1 n/a
5 TRCN0000049211 CGGCTACATCCAGAAGATCAA pLKO.1 297 3UTR 100% 4.950 2.475 Y PIN1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01205 pDONR223 100% 44.5% None (many diffs) n/a
2 ccsbBroad304_01205 pLX_304 0% 44.5% V5 (many diffs) n/a
3 TRCN0000480320 GTTTATTCAGGTGGAAAAAATGGG pLX_317 62.6% 44.5% V5 (many diffs) n/a
Download CSV