Transcript: Human NR_024055.2

Homo sapiens zinc finger protein 542, pseudogene (ZNF542P), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Homo sapiens (human)
Gene:
ZNF542P (147947)
Length:
3412
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024055.2
NBCI Gene record:
ZNF542P (147947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107549 CTTATAGATCACCAGCGAATT pLKO.1 924 3UTR 100% 0.000 0.000 N ZNF542P n/a
2 TRCN0000107548 TCCACACTTTGTCAACATAAT pLKO.1 1422 3UTR 100% 13.200 9.240 N ZNF542P n/a
3 TRCN0000107547 CCCTGATTGAACATTGGAGAA pLKO.1 1090 3UTR 100% 4.050 2.835 N ZNF542P n/a
4 TRCN0000107546 CCACACTTTGTCAACATAATA pLKO.1 1423 3UTR 100% 15.000 9.000 N ZNF542P n/a
5 TRCN0000107545 CCCTAATGTAAATGACGAGTT pLKO.1 1808 3UTR 100% 4.050 2.430 N ZNF542P n/a
6 TRCN0000073773 CCTCTCAAGTAGCTGGGACTA pLKO.1 2194 3UTR 100% 4.050 2.025 Y TINAGL1 n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2199 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10553 pDONR223 100% 21.1% None 1_830del;1554_3412del n/a
2 ccsbBroad304_10553 pLX_304 0% 21.1% V5 1_830del;1554_3412del n/a
3 TRCN0000477935 CGAGGCAAAGTAATCGCCAAAATT pLX_317 63.1% 21.1% V5 1_830del;1554_3412del n/a
Download CSV