Transcript: Human NR_024335.2

Homo sapiens long intergenic non-protein coding RNA 905 (LINC00905), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC00905 (148231)
Length:
1728
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024335.2
NBCI Gene record:
LINC00905 (148231)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165246 GAACTTCACTAGACACGCATC pLKO.1 834 3UTR 100% 2.250 3.150 N LINC00905 n/a
2 TRCN0000161857 GCTTGAAGGAAATGTCTACTT pLKO.1 1515 3UTR 100% 4.950 3.465 N LINC00905 n/a
3 TRCN0000158747 GAAATTATCCTTGAACCAGAA pLKO.1 377 3UTR 100% 4.050 2.835 N LINC00905 n/a
4 TRCN0000166102 GATTCACTGTTGGCTCCAGAA pLKO.1 1557 3UTR 100% 4.050 2.835 N LINC00905 n/a
5 TRCN0000163290 GATCTCAAGTCTCTACTGGAA pLKO.1 503 3UTR 100% 2.640 1.848 N LINC00905 n/a
6 TRCN0000165302 GTTGTGGTAAACAGTGCTGCA pLKO.1 477 3UTR 100% 2.160 1.512 N LINC00905 n/a
7 TRCN0000165613 GCTGCATCTGTGATCTCAAGT pLKO.1 492 3UTR 100% 4.950 2.970 N LINC00905 n/a
8 TRCN0000166103 GTGCTGCATCTGTGATCTCAA pLKO.1 490 3UTR 100% 4.950 2.970 N LINC00905 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10554 pDONR223 100% 35.5% None 1_328del;769A>G;944_1728del n/a
2 ccsbBroad304_10554 pLX_304 0% 35.5% V5 1_328del;769A>G;944_1728del n/a
3 TRCN0000470573 TCATGCTACCCTCAAGGCTACCTT pLX_317 68.1% 35.5% V5 1_328del;769A>G;944_1728del n/a
Download CSV