Transcript: Human NR_024516.2

Homo sapiens amyloid beta precursor like protein 2 (APLP2), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
APLP2 (334)
Length:
3267
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024516.2
NBCI Gene record:
APLP2 (334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315227 CTCAGGGAATGACCTTATATA pLKO_005 313 3UTR 100% 15.000 21.000 N APLP2 n/a
2 TRCN0000006701 CCAATGATGTTGATGTGTATT pLKO.1 730 3UTR 100% 13.200 18.480 N APLP2 n/a
3 TRCN0000006700 CGTTCCGGTTATGTTGTGTAA pLKO.1 2285 3UTR 100% 4.950 6.930 N APLP2 n/a
4 TRCN0000006704 CGCTTACATACCATCCGTCAT pLKO.1 1128 3UTR 100% 4.050 5.670 N APLP2 n/a
5 TRCN0000315160 CACTTCCAAGCCATGGTTAAA pLKO_005 915 3UTR 100% 13.200 10.560 N APLP2 n/a
6 TRCN0000369133 TGGACTGTAGGACTATATAAA pLKO_005 2030 3UTR 100% 15.000 10.500 N APLP2 n/a
7 TRCN0000006703 CCTGGAGCAGATGCAGATTTA pLKO.1 1889 3UTR 100% 13.200 9.240 N APLP2 n/a
8 TRCN0000315225 CCTGGAGCAGATGCAGATTTA pLKO_005 1889 3UTR 100% 13.200 9.240 N APLP2 n/a
9 TRCN0000424640 GCCGAAGAGAAAGTGATTAAC pLKO_005 1530 3UTR 100% 13.200 9.240 N APLP2 n/a
10 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 450 3UTR 100% 4.950 2.475 Y NPM2 n/a
11 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 429 3UTR 100% 4.950 2.475 Y NPM2 n/a
12 TRCN0000092929 GAGGAAGATGAAGAGGAAGAA pLKO.1 438 3UTR 100% 4.950 2.475 Y Gm13237 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.