Transcript: Human NR_024581.2

Homo sapiens ankyrin repeat and SOCS box containing 13 (ASB13), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ASB13 (79754)
Length:
2566
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024581.2
NBCI Gene record:
ASB13 (79754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135489 GAATGTTGACCTCATCGAGAT pLKO.1 472 3UTR 100% 4.050 5.670 N ASB13 n/a
2 TRCN0000135732 CATCGAGATGCTTATCGAGTT pLKO.1 484 3UTR 100% 4.050 2.835 N ASB13 n/a
3 TRCN0000135192 CAAGGTCAAGAATGTTGACCT pLKO.1 463 3UTR 100% 0.264 0.185 N ASB13 n/a
4 TRCN0000136591 CCCACAAGTAGCACTGAGTTT pLKO.1 1389 3UTR 100% 4.950 2.970 N ASB13 n/a
5 TRCN0000136702 GCTGGAGAAGATTGCCAAGTT pLKO.1 667 3UTR 100% 4.950 2.970 N ASB13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10251 pDONR223 100% 13.4% None 1_44del;274_275ins151;411_2566delinsCT n/a
2 ccsbBroad304_10251 pLX_304 0% 13.4% V5 1_44del;274_275ins151;411_2566delinsCT n/a
3 TRCN0000481338 TGACCTCCATATCCGCAGTGCCGC pLX_317 92.5% 13.4% V5 1_44del;274_275ins151;411_2566delinsCT n/a
Download CSV