Transcript: Human NR_026677.1

Homo sapiens MIR600 host gene (MIR600HG), long non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
MIR600HG (81571)
Length:
6002
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026677.1
NBCI Gene record:
MIR600HG (81571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145588 CATGTAGGACTCTGAACTTTA pLKO.1 5695 3UTR 100% 13.200 6.600 Y MIR600HG n/a
2 TRCN0000121686 GAGATGCTTTGCTACTACTTA pLKO.1 4636 3UTR 100% 5.625 2.813 Y MIR600HG n/a
3 TRCN0000144472 CCTTGGCAATAACTTTGTGTA pLKO.1 5608 3UTR 100% 4.950 2.475 Y MIR600HG n/a
4 TRCN0000142655 GCCAGGTTCATCATACCGTTA pLKO.1 5166 3UTR 100% 4.050 2.025 Y MIR600HG n/a
5 TRCN0000141831 GCACTGAGTATGTTGGACTCT pLKO.1 5852 3UTR 100% 2.640 1.320 Y MIR600HG n/a
6 TRCN0000122822 GCTCACTTCATGTGGCAGCTT pLKO.1 4586 3UTR 100% 2.640 1.320 Y MIR600HG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.