Transcript: Human NR_026735.1

Homo sapiens GPN-loop GTPase 1 (GPN1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
GPN1 (11321)
Length:
1742
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026735.1
NBCI Gene record:
GPN1 (11321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047666 GCCCAGAACATGTCCAAATAT pLKO.1 290 3UTR 100% 15.000 21.000 N GPN1 n/a
2 TRCN0000331196 GCCCAGAACATGTCCAAATAT pLKO_005 290 3UTR 100% 15.000 21.000 N GPN1 n/a
3 TRCN0000047663 CCTGAATATGAACGTCTGAAA pLKO.1 767 3UTR 100% 4.950 6.930 N GPN1 n/a
4 TRCN0000299939 CCTGAATATGAACGTCTGAAA pLKO_005 767 3UTR 100% 4.950 6.930 N GPN1 n/a
5 TRCN0000047665 CCTTGAATCAAGAGACTACAT pLKO.1 591 3UTR 100% 4.950 3.960 N GPN1 n/a
6 TRCN0000299928 CCTTGAATCAAGAGACTACAT pLKO_005 591 3UTR 100% 4.950 3.960 N GPN1 n/a
7 TRCN0000047664 GCAGTACATGAAGTTCCCTTT pLKO.1 235 3UTR 100% 4.050 2.835 N GPN1 n/a
8 TRCN0000299987 GCAGTACATGAAGTTCCCTTT pLKO_005 235 3UTR 100% 4.050 2.835 N GPN1 n/a
9 TRCN0000039173 GACCACAGAGTTACAGAGGAA pLKO.1 986 3UTR 100% 2.640 1.848 N Gpn1 n/a
10 TRCN0000308879 GACCACAGAGTTACAGAGGAA pLKO_005 986 3UTR 100% 2.640 1.848 N Gpn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11620 pDONR223 100% 54.8% None 1_63del;267_268ins107;1079_1742del n/a
2 ccsbBroad304_11620 pLX_304 0% 54.8% V5 1_63del;267_268ins107;1079_1742del n/a
3 TRCN0000470336 GCCGTGAGGGCACGAAACATGGAT pLX_317 40.9% 54.8% V5 1_63del;267_268ins107;1079_1742del n/a
Download CSV