Transcript: Human NR_026865.2

Homo sapiens long intergenic non-protein coding RNA 1006 (LINC01006), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-08-19
Taxon:
Homo sapiens (human)
Gene:
LINC01006 (100506380)
Length:
3350
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026865.2
NBCI Gene record:
LINC01006 (100506380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167184 CCATAAATGGTTGTAAGACTT pLKO.1 1331 3UTR 100% 4.950 3.960 N n/a
2 TRCN0000172949 GCTTCCCTTCTCTTAAGGATC pLKO.1 940 3UTR 100% 4.050 2.835 N n/a
3 TRCN0000166963 GAAGCAGAAATGAGTAAAGTT pLKO.1 1068 3UTR 100% 5.625 3.375 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10546 pDONR223 100% 7.8% None 1_758del;1023_3350del n/a
2 ccsbBroad304_10546 pLX_304 0% 7.8% V5 1_758del;1023_3350del n/a
3 TRCN0000475961 TAATGTCTGTGACTGAACTTATTA pLX_317 100% 7.8% V5 1_758del;1023_3350del n/a
Download CSV