Transcript: Human NR_027257.2

Homo sapiens uncharacterized LOC400710 (LOC400710), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC400710 (400710)
Length:
1542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027257.2
NBCI Gene record:
LOC400710 (400710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140652 CACGAAGTCGTGGCTTATTCT pLKO.1 381 3UTR 100% 5.625 7.875 N LOC400710 n/a
2 TRCN0000145044 CCTAATGATTGGACGTACAAA pLKO.1 1194 3UTR 100% 5.625 7.875 N LOC400710 n/a
3 TRCN0000144784 GCCAAGACTTATTTGTTGTGT pLKO.1 1223 3UTR 100% 3.000 2.400 N LOC400710 n/a
4 TRCN0000139460 CACACGAAGTCGTGGCTTATT pLKO.1 379 3UTR 100% 13.200 9.240 N LOC400710 n/a
5 TRCN0000144577 GTCTATTTCCTGTGGATCAAT pLKO.1 444 3UTR 100% 5.625 3.938 N LOC400710 n/a
6 TRCN0000139917 GTCAGACTCCCTGATGAACTA pLKO.1 258 3UTR 100% 4.950 3.465 N LOC400710 n/a
7 TRCN0000122650 GCGTCTATTTCCTGTGGATCA pLKO.1 442 3UTR 100% 4.050 2.835 N LOC400710 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10374 pDONR223 100% 23.7% None 1_114del;481_1542del n/a
2 ccsbBroad304_10374 pLX_304 0% 23.7% V5 1_114del;481_1542del n/a
3 TRCN0000465907 CTATAGACTTTCTCCCTCCCAACA pLX_317 80.7% 23.7% V5 1_114del;481_1542del n/a
Download CSV