Transcript: Human NR_027383.2

Homo sapiens A-kinase anchoring protein 17A (AKAP17A), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
AKAP17A (8227)
Length:
3269
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027383.2
NBCI Gene record:
AKAP17A (8227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218426 ACTTGATCCGATAGCTTTAAT pLKO_005 2577 3UTR 100% 15.000 21.000 N AKAP17A n/a
2 TRCN0000229796 AGTTCTCCACGCTGCGTATTT pLKO_005 373 3UTR 100% 13.200 18.480 N AKAP17A n/a
3 TRCN0000022044 GCGTATTTCCAAGAGCACCAT pLKO.1 386 3UTR 100% 2.640 3.696 N AKAP17A n/a
4 TRCN0000229797 ACGTCCTGGTCAAGGTGTTTG pLKO_005 700 3UTR 100% 10.800 8.640 N AKAP17A n/a
5 TRCN0000022045 CCTGAGTGATGCCTCAATTAA pLKO.1 971 3UTR 100% 15.000 10.500 N AKAP17A n/a
6 TRCN0000229798 CTGAGTGATGCCTCAATTAAG pLKO_005 972 3UTR 100% 13.200 9.240 N AKAP17A n/a
7 TRCN0000257207 GGCCTGCAACATCAAGGTTTC pLKO_005 932 3UTR 100% 6.000 4.200 N AKAP17A n/a
8 TRCN0000022046 CCTGCAACATCAAGGTTTCTT pLKO.1 934 3UTR 100% 5.625 3.938 N AKAP17A n/a
9 TRCN0000022048 GAGCGGAGGAAAGGAAACAAA pLKO.1 1084 3UTR 100% 5.625 3.938 N AKAP17A n/a
10 TRCN0000022047 CTCCTGCATTCCTGACAACAA pLKO.1 1896 3UTR 100% 4.950 3.465 N AKAP17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07209 pDONR223 100% 63.6% None (many diffs) n/a
2 ccsbBroadEn_11263 pDONR223 100% 39.6% None (many diffs) n/a
Download CSV