Transcript: Human NR_027427.1

Homo sapiens TatD DNase domain containing 1 (TATDN1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
TATDN1 (83940)
Length:
1158
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027427.1
NBCI Gene record:
TATDN1 (83940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424867 CGAAACTCACATGCTGAATTT pLKO_005 493 3UTR 100% 13.200 10.560 N TATDN1 n/a
2 TRCN0000155262 GCTGTCGAGATTGGTGTTAAA pLKO.1 157 3UTR 100% 13.200 9.240 N TATDN1 n/a
3 TRCN0000425301 TTTGATTGACTTGGATCTTTA pLKO_005 597 3UTR 100% 13.200 9.240 N TATDN1 n/a
4 TRCN0000427802 GAAATCTACAAGACAGTAAAG pLKO_005 197 3UTR 100% 10.800 7.560 N TATDN1 n/a
5 TRCN0000156010 CCACTGGAATTAGCCAATACA pLKO.1 986 3UTR 100% 5.625 3.938 N TATDN1 n/a
6 TRCN0000154331 CAGTTGGATGTCATCCTACAA pLKO.1 260 3UTR 100% 4.950 3.465 N TATDN1 n/a
7 TRCN0000157196 GCAATAGGAGAATGCGGACTT pLKO.1 367 3UTR 100% 4.050 2.835 N TATDN1 n/a
8 TRCN0000157162 GACAGAAATGAACCCTGCCAT pLKO.1 920 3UTR 100% 2.640 1.848 N TATDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09136 pDONR223 100% 76.8% None (many diffs) n/a
2 ccsbBroad304_09136 pLX_304 0% 76.8% V5 (many diffs) n/a
3 TRCN0000480484 AAATAACTTCCTAAAATAAATTGC pLX_317 49.6% 76.8% V5 (many diffs) n/a
Download CSV