Transcript: Mouse NR_027641.1

Mus musculus SEC16 homolog B (S. cerevisiae) (Sec16b), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Sec16b (89867)
Length:
4443
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027641.1
NBCI Gene record:
Sec16b (89867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216523 GATTCGACTCCTTCAGATATT pLKO.1 2337 3UTR 100% 13.200 18.480 N Sec16b n/a
2 TRCN0000192701 GACCATCAAGGGATACAAATA pLKO.1 235 3UTR 100% 13.200 10.560 N Sec16b n/a
3 TRCN0000350123 GACCATCAAGGGATACAAATA pLKO_005 235 3UTR 100% 13.200 10.560 N Sec16b n/a
4 TRCN0000215545 GACTACTTGAAAGGATCTTAT pLKO.1 435 3UTR 100% 13.200 10.560 N Sec16b n/a
5 TRCN0000201652 CCCTCCTTAGACTTGCTTAAA pLKO.1 3782 3UTR 100% 13.200 9.240 N Sec16b n/a
6 TRCN0000146822 CAAATCCTTCATCCCTTCTTT pLKO.1 2027 3UTR 100% 5.625 3.938 N SEC16B n/a
7 TRCN0000192374 CCACAGTCAAGAGTTTATGAA pLKO.1 1940 3UTR 100% 5.625 3.938 N Sec16b n/a
8 TRCN0000350124 CCACAGTCAAGAGTTTATGAA pLKO_005 1940 3UTR 100% 5.625 3.938 N Sec16b n/a
9 TRCN0000192228 CCAGTTCCAATTTACCAGTAA pLKO.1 701 3UTR 100% 4.950 3.465 N Sec16b n/a
10 TRCN0000319806 CCAGTTCCAATTTACCAGTAA pLKO_005 701 3UTR 100% 4.950 3.465 N Sec16b n/a
11 TRCN0000201223 GCTGTTTGTCAGATTTGCTTA pLKO.1 4291 3UTR 100% 4.950 3.465 N Sec16b n/a
12 TRCN0000189584 CTGTCAAATCAGGCTGGAGAT pLKO.1 1767 3UTR 100% 4.050 2.835 N Sec16b n/a
13 TRCN0000319872 CTGTCAAATCAGGCTGGAGAT pLKO_005 1767 3UTR 100% 4.050 2.835 N Sec16b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.