Transcript: Mouse NR_027809.1

Mus musculus 5,10-methylenetetrahydrofolate reductase (Mthfr), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mthfr (17769)
Length:
5016
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027809.1
NBCI Gene record:
Mthfr (17769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042175 GCACAGAGATAGGCATCTCTT pLKO.1 871 3UTR 100% 0.495 0.693 N Mthfr n/a
2 TRCN0000042174 CCGCATGATCATCCAATACAT pLKO.1 1958 3UTR 100% 5.625 4.500 N Mthfr n/a
3 TRCN0000042173 GCTGGGCCTGAAGAACATAAT pLKO.1 584 3UTR 100% 13.200 9.240 N Mthfr n/a
4 TRCN0000042176 GATGTAATTGAGCCCATCAAA pLKO.1 987 3UTR 100% 5.625 3.938 N Mthfr n/a
5 TRCN0000042177 GCTTGGAAACCATCCTGCATA pLKO.1 505 3UTR 100% 4.950 3.465 N Mthfr n/a
6 TRCN0000235023 ATGCTGCCATCCGCAACTATG pLKO_005 1015 3UTR 100% 10.800 7.560 N MTHFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489142 GTTAAGGTAGCTATGACGCGCGCT pLX_317 18.4% 34.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492338 GACACATACGAACAAAGCGCTTTC pLX_317 20.4% 34.1% V5 (many diffs) n/a
Download CSV