Transcript: Mouse NR_027864.1

Mus musculus TAR DNA binding protein (Tardbp), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Tardbp (230908)
Length:
5774
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027864.1
NBCI Gene record:
Tardbp (230908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016041 GCAATAGACAGTTAGAAAGAA pLKO.1 1127 3UTR 100% 5.625 3.938 N TARDBP n/a
2 TRCN0000174813 GAATATGAAACCCAAGTGAAA pLKO.1 790 3UTR 100% 4.950 3.465 N Tardbp n/a
3 TRCN0000174930 GCTTTGTTCGATTTACAGAAT pLKO.1 773 3UTR 100% 4.950 3.465 N Tardbp n/a
4 TRCN0000173538 GCAGAGCATATCAATGGGAAA pLKO.1 1728 3UTR 100% 4.050 2.835 N Tardbp n/a
5 TRCN0000175828 GTAGATGTCTTCATTCCCAAA pLKO.1 982 3UTR 100% 4.050 2.835 N Tardbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14085 pDONR223 100% 12.1% None (many diffs) n/a
2 ccsbBroad304_14085 pLX_304 0% 12.1% V5 (many diffs) n/a
3 TRCN0000469717 TCTACAAATTAAAGCTAACCCTAA pLX_317 58.1% 12.1% V5 (many diffs) n/a
Download CSV