Transcript: Human NR_028049.1

Homo sapiens mitochondrial transcription termination factor 4 (MTERF4), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
MTERF4 (130916)
Length:
4574
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028049.1
NBCI Gene record:
MTERF4 (130916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438960 ATGCGCCAGCAGGACATTAAC pLKO_005 624 3UTR 100% 13.200 18.480 N MTERF4 n/a
2 TRCN0000173027 CGCGCTATATCGGCCATTAAA pLKO.1 3855 3UTR 100% 15.000 12.000 N MTERF4 n/a
3 TRCN0000431431 ATCTTGTGTTAGATCCAATAA pLKO_005 224 3UTR 100% 13.200 10.560 N MTERF4 n/a
4 TRCN0000166991 CTGGACATCATTTCAGAATTT pLKO.1 432 3UTR 100% 13.200 10.560 N MTERF4 n/a
5 TRCN0000430550 GTTTCAGCAATGCCCATATTA pLKO_005 367 3UTR 100% 15.000 10.500 N MTERF4 n/a
6 TRCN0000420922 GATTAAGCAGAGACACATTTA pLKO_005 839 3UTR 100% 13.200 9.240 N MTERF4 n/a
7 TRCN0000167068 CCATCCTGAATAAGATACTTA pLKO.1 1437 3UTR 100% 5.625 3.938 N MTERF4 n/a
8 TRCN0000172359 CCTGGGTCAACTGGAATACAA pLKO.1 737 3UTR 100% 5.625 3.938 N MTERF4 n/a
9 TRCN0000167014 GAAATTAAAGAGGGTGCTTTA pLKO.1 581 3UTR 100% 1.080 0.756 N MTERF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15243 pDONR223 95.3% 24.9% None (many diffs) n/a
2 ccsbBroad304_15243 pLX_304 0% 24.9% V5 (many diffs) n/a
3 TRCN0000481459 GGGCGTGAGATAAAAGTGTAAAAT pLX_317 38.4% 24.1% V5 (many diffs) n/a
Download CSV