Transcript: Human NR_028092.1

Homo sapiens lipoprotein(a) like 2, pseudogene (LPAL2), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LPAL2 (80350)
Length:
2041
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028092.1
NBCI Gene record:
LPAL2 (80350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118393 CTAGAGGATTCATTCATACAA pLKO.1 487 3UTR 100% 5.625 7.875 N LPAL2 n/a
2 TRCN0000118394 AGCCTAGAGGATTCATTCATA pLKO.1 484 3UTR 100% 5.625 3.938 N LPAL2 n/a
3 TRCN0000118395 TGATGGCTTGATCTCGAACTA pLKO.1 324 3UTR 100% 4.950 3.465 N LPAL2 n/a
4 TRCN0000118396 TGACTGTTATCCCAGTTCCAA pLKO.1 464 3UTR 100% 3.000 2.100 N LPAL2 n/a
5 TRCN0000118392 CCCTGGTGTTACACAACTGAT pLKO.1 1211 3UTR 100% 4.950 2.970 N LPAL2 n/a
6 TRCN0000052010 CCACGGTAATGGACAGAGTTA pLKO.1 1070 3UTR 100% 4.950 2.475 Y LPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10258 pDONR223 100% 19.4% None 1_117del;514_2041del n/a
2 ccsbBroad304_10258 pLX_304 0% 19.4% V5 1_117del;514_2041del n/a
3 TRCN0000481339 TCCACTATCATGCACACGATATAC pLX_317 91.8% 19.4% V5 1_117del;514_2041del n/a
Download CSV