Transcript: Human NR_029402.1

Homo sapiens chaperonin containing TCP1 subunit 7 (CCT7), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
CCT7 (10574)
Length:
1895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_029402.1
NBCI Gene record:
CCT7 (10574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_029402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146527 GCAGAGGCAAAGCAACAATTT pLKO.1 298 3UTR 100% 13.200 9.240 N CCT7 n/a
2 TRCN0000147343 GCAAAGACTTTGGTAGACATT pLKO.1 369 3UTR 100% 4.950 3.465 N CCT7 n/a
3 TRCN0000281356 GCAAAGACTTTGGTAGACATT pLKO_005 369 3UTR 100% 4.950 3.465 N CCT7 n/a
4 TRCN0000149865 GCCAAAGTTGTCTTGTCCAAA pLKO.1 946 3UTR 100% 4.950 3.465 N CCT7 n/a
5 TRCN0000281277 GCCAAAGTTGTCTTGTCCAAA pLKO_005 946 3UTR 100% 4.950 3.465 N CCT7 n/a
6 TRCN0000147373 GCCACAATTCTGAAACTTCTT pLKO.1 330 3UTR 100% 4.950 3.465 N CCT7 n/a
7 TRCN0000281355 GCCACAATTCTGAAACTTCTT pLKO_005 330 3UTR 100% 4.950 3.465 N CCT7 n/a
8 TRCN0000149108 GCTGAGTGGAACATTCTCTAT pLKO.1 895 3UTR 100% 4.950 3.465 N CCT7 n/a
9 TRCN0000281354 GCTGAGTGGAACATTCTCTAT pLKO_005 895 3UTR 100% 4.950 3.465 N CCT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_029402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07641 pDONR223 100% 80.8% None (many diffs) n/a
2 ccsbBroad304_07641 pLX_304 0% 80.8% V5 (many diffs) n/a
3 TRCN0000466543 TTCTGTAACGCGAACGGGTCCGGC pLX_317 23.1% 80.8% V5 (many diffs) n/a
Download CSV