Transcript: Human NR_029467.2

Homo sapiens selectin L (SELL), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SELL (6402)
Length:
2205
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_029467.2
NBCI Gene record:
SELL (6402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_029467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423124 TGATTAAGGAGGGTGATTATA pLKO_005 943 3UTR 100% 15.000 12.000 N SELL n/a
2 TRCN0000057796 GAAGTATGAATGACCCATATT pLKO.1 1066 3UTR 100% 13.200 10.560 N SELL n/a
3 TRCN0000428098 GGTCAAATCCTAGTCCAATAT pLKO_005 895 3UTR 100% 13.200 10.560 N SELL n/a
4 TRCN0000057793 GCCGAGACAATTACACAGATT pLKO.1 139 3UTR 100% 4.950 3.960 N SELL n/a
5 TRCN0000057795 CCATGGAGAATGTGTAGAAAT pLKO.1 470 3UTR 100% 13.200 9.240 N SELL n/a
6 TRCN0000057794 GCTCAGAAGGAACTGAGTTAA pLKO.1 835 3UTR 100% 1.320 0.792 N SELL n/a
7 TRCN0000066768 CCCAACAACAAGAAGAACAAT pLKO.1 324 3UTR 100% 5.625 3.938 N Selp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_029467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13950 pDONR223 100% 45.4% None (many diffs) n/a
2 ccsbBroad304_13950 pLX_304 0% 45.4% V5 (many diffs) n/a
3 TRCN0000474809 TCTCCGCCTAGACGTCAGAGTACG pLX_317 48.9% 45.4% V5 (many diffs) n/a
Download CSV