Transcript: Mouse NR_030771.1

Mus musculus predicted gene 13034 (Gm13034), non-coding RNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm13034 (627585)
Length:
1195
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_030771.1
NBCI Gene record:
Gm13034 (627585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_030771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284473 GGAGGATGAAGAGCTATTAAC pLKO_005 693 3UTR 100% 13.200 6.600 Y Gm13034 n/a
2 TRCN0000270932 TGGGATCCTTGCAGATGAAAT pLKO_005 846 3UTR 100% 13.200 6.600 Y Gm13034 n/a
3 TRCN0000270930 TTGGATACATGAAACACTATA pLKO_005 902 3UTR 100% 13.200 6.600 Y Gm13034 n/a
4 TRCN0000270931 ACTAATGTTTGTACTCGATTT pLKO_005 730 3UTR 100% 10.800 5.400 Y Gm13034 n/a
5 TRCN0000284472 TTAGGTCTGTTTGCTTGATAG pLKO_005 1010 3UTR 100% 10.800 5.400 Y Gm13034 n/a
6 TRCN0000084430 GTTTGGGAAAGACACTTCAAA pLKO.1 869 3UTR 100% 5.625 2.813 Y Smarca5 n/a
7 TRCN0000288446 GTTTGGGAAAGACACTTCAAA pLKO_005 869 3UTR 100% 5.625 2.813 Y Smarca5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_030771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14896 pDONR223 97.7% 24.6% None (many diffs) n/a
2 ccsbBroad304_14896 pLX_304 0% 24.6% V5 (many diffs) n/a
3 TRCN0000479258 GTACCACCTGTGGCTCGGAAGTAG pLX_317 16.3% 24.6% V5 (many diffs) n/a
Download CSV