Transcript: Human NR_033231.3

Homo sapiens sphingomyelin phosphodiesterase 4 (SMPD4), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SMPD4 (55627)
Length:
3606
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033231.3
NBCI Gene record:
SMPD4 (55627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245616 AGTGCCAAGACTTGGTTAAAG pLKO_005 201 3UTR 100% 13.200 7.920 N SMPD4 n/a
2 TRCN0000245618 CCCTGAATCCGTTCGAGTATT pLKO_005 424 3UTR 100% 13.200 7.920 N SMPD4 n/a
3 TRCN0000172804 GCAGTGCCAAGACTTGGTTAA pLKO.1 199 3UTR 100% 10.800 6.480 N SMPD4 n/a
4 TRCN0000245620 CCTGAAAGCTGACTCTATAAA pLKO_005 163 3UTR 100% 15.000 7.500 Y SMPD4 n/a
5 TRCN0000245617 ACTTCAGACTGTGCCTATTTC pLKO_005 510 3UTR 100% 13.200 6.600 Y SMPD4 n/a
6 TRCN0000124165 GCCTGAAAGCTGACTCTATAA pLKO.1 162 3UTR 100% 13.200 6.600 Y Smpd4 n/a
7 TRCN0000331603 GCCTGAAAGCTGACTCTATAA pLKO_005 162 3UTR 100% 13.200 6.600 Y Smpd4 n/a
8 TRCN0000245619 GGAGTACCTGCGCCAGATATT pLKO_005 1844 3UTR 100% 13.200 6.600 Y SMPD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12238 pDONR223 100% 61.1% None 1_251del;710G>A;2457_3606del n/a
2 ccsbBroad304_12238 pLX_304 0% 61.1% V5 1_251del;710G>A;2457_3606del n/a
3 TRCN0000477592 CCTTTCAAACCCGATGTTAGGCCA pLX_317 5% 61.1% V5 1_251del;710G>A;2457_3606del n/a
Download CSV