Construct: ORF TRCN0000477592
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007847.1_s317c1
- Derived from:
- ccsbBroadEn_12238
- DNA Barcode:
- CCTTTCAAACCCGATGTTAGGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMPD4 (55627)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477592
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_011511445.2 | 99.9% | 100% | 459G>A |
| 2 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | NM_001171083.2 | 87.5% | 85.3% | (many diffs) |
| 3 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | NM_017951.4 | 84.8% | 84.8% | 1_393del;852G>A |
| 4 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | NM_017751.4 | 81.4% | 81.5% | 1_393del;852G>A;981_982ins87 |
| 5 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_011511443.2 | 77.8% | 77.8% | 1_627del;1086G>A |
| 6 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_017004448.2 | 76% | 71.3% | 0_1ins466;210_291del |
| 7 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_024452978.1 | 76% | 71.3% | 0_1ins466;210_291del |
| 8 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_011511444.3 | 74.7% | 74.7% | 1_627del;1086G>A;1215_1216ins87 |
| 9 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | NR_033231.3 | 61.1% | 1_251del;710G>A;2457_3606del | |
| 10 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XM_017004449.2 | 58.2% | 58.2% | 0_1ins921 |
| 11 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | NR_033232.3 | 57.1% | (many diffs) | |
| 12 | human | 150776 | LOC150776 | sphingomyelin phosphodieste... | NR_026922.1 | 48.4% | (many diffs) | |
| 13 | human | 55627 | SMPD4 | sphingomyelin phosphodieste... | XR_002959315.1 | 27.2% | (many diffs) | |
| 14 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | NM_029945.3 | 75.4% | 79.3% | (many diffs) |
| 15 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XM_006522722.2 | 75.4% | 79.3% | (many diffs) |
| 16 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XM_006522720.3 | 72.8% | 76.5% | (many diffs) |
| 17 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | NM_001164610.1 | 72.1% | 76% | (many diffs) |
| 18 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | NM_001164611.1 | 72% | 75.9% | (many diffs) |
| 19 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | NM_001164609.1 | 71% | 74.8% | (many diffs) |
| 20 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XM_006522721.3 | 69.6% | 73.3% | (many diffs) |
| 21 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XM_006522725.2 | 65.6% | 59.8% | (many diffs) |
| 22 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XR_001781871.1 | 53.5% | (many diffs) | |
| 23 | mouse | 77626 | Smpd4 | sphingomyelin phosphodieste... | XR_001781872.1 | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2271
- ORF length:
- 2205
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gaagttggtt tataagcttc aagctgaaga ctataagttc gactttcctg 121 tctcctactt gcctggtcct gtgaaggcgt ccatccagga gtgcatcctc cctgacagtc 181 ctctgtacca caacaaggtc cagttcaccc ctactggggg ccttggtctg aacttggccc 241 tgaatccgtt cgagtattac atattcttct ttgccttgag cctcatcact cagaagccac 301 ttcctgtgtc cctccacgtc cgtacttcag actgtgccta tttcatcctg gtggacaggt 361 acctgtcatg gttcctgccc accgaaggca gtgtgccccc accactctcc tccagcccag 421 gggggaccag cccctcacca cctcccagga caccagccat accctttgct tcctatggcc 481 tccaccacac tagcctccta aagcgacaca tctctcatca gacatctgtg aatgcagacc 541 ccgcctccca cgagatctgg aggtcagaaa ctctgctcca ggtttttgtt gaaatgtggc 601 ttcatcacta ttccttggag atgtatcaaa aaatgcagtc ccctcatgcc aagctggagg 661 ttctgcacta ccgactcagt gtctccagcg ccctctacag ccccgcccaa cccagcctcc 721 aggccctcca cgcctaccaa gagtcgttca cgcctactga ggagcatgtg ttggtggtgc 781 gcctgctgct gaagcacctg cacgcctttg ccaacagcct gaagccagag caggcctcac 841 cctccgccca ctcccacgcc accagccccc tggaggagtt caaacgggct gctgtcccga 901 ggttcgtcca gcagaaactc tacctcttct tgcagcattg ctttggccac tggcccctgg 961 acgcatcgtt cagagctgtc ctggagatgt ggctgagcta cctgcagccg tggcggtacg 1021 cgcctgacaa gcaggctccg ggcagcgact cccagccccg gtgtgtgtcg gagaaatggg 1081 caccctttgt ccaggagaac ctgctgatgt acaccaagtt gtttgtgggc tttctgaacc 1141 gcgcgctccg cacagacctg gtcagcccca agcacgcgct catggtgttc cgagtggcca 1201 aagtctttgc ccagcccaac ctggctgaga tgattcagaa aggtgagcag ctattcctgg 1261 agccagagct ggtcatcccc caccgccagc accgactctt cacggccccc acattcactg 1321 ggagcttcct gtcaccctgg ccaccagcgg tcactgatgc ctccttcaag gtgaagagcc 1381 acgtctacag cctggagggc caggactgca agtacacccc gatgtttggg cccgaggccc 1441 gcaccctggt cctgcgcctc gctcagctca tcacacaggc caaacacaca gccaagtcca 1501 tctccgacca gtgtgcggag agcccggctg gccactcctt cctctcatgg ctgggcttta 1561 gctccatgga caccaatggc tcctacacag ccaacgacct ggacgagatg gggcaagaca 1621 gtgtccggaa gacagatgaa tacctggaga aggccctgga gtacctgcgc cagatattcc 1681 ggctcagcga agcgcagctc aggcagttca cactcgcctt gggcaccacc caggatgaga 1741 atggaaaaaa gcaactcccc gactgcatcg tgggtgagga cggactcatc cttacgcccc 1801 tggggcggta ccagatcatc aatgggctgc gaaggtttga aattgagtac cagggggacc 1861 cggagctgca gcccatccgg agctatgaga tcgccagctt ggtccgcaca ctctttaggc 1921 tgtcgtctgc catcaaccac agatttgcag gacagatggc ggctctgtgt tcccgggatg 1981 acttcctcgg cagcttctgt cgctaccacc tcacagaacc tgggctggcc agcaggcacc 2041 tgctgagccc tgtggggcgg aggcaggtgg ccggccacac ccgcggcccc aggctcagcc 2101 tgcgcttcct gggcagttac cggacgctgg tctcgctgct gctggccttc ttcgtggcct 2161 ctctgttcTG CGTCGGGCCC CTCCCATGCA CGCTGCTGCT CACCCTGGGC TATGTCCTCT 2221 ACGCCTCTGC CATGACACTG CTGACCGAGC GGGGGAAGCT GCACCAGCCC TGCCCAACTT 2281 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2341 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2401 CTTGTGGAAA GGACGACCTT TCAAACCCGA TGTTAGGCCA ACGCGTTAAG TCgacaatca 2461 acctctggat tacaaaattt gtgaaagatt