Transcript: Human NR_033248.1

Homo sapiens glycine cleavage system protein H pseudogene 3 (GCSHP3), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
GCSHP3 (100329109)
Length:
1000
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033248.1
NBCI Gene record:
GCSHP3 (100329109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083395 GTGAACTCTATTCTCCTTTAT pLKO.1 270 3UTR 100% 13.200 6.600 Y GCSH n/a
2 TRCN0000414026 GTGGATAGAAGACTTAGAATA pLKO_005 529 3UTR 100% 13.200 6.600 Y GCSH n/a
3 TRCN0000083396 GATGAACTTATGAGTGAAGAA pLKO.1 407 3UTR 100% 4.950 2.475 Y GCSH n/a
4 TRCN0000101603 TCTGCCTGAAGTTGGGACAAA pLKO.1 199 3UTR 100% 4.950 2.475 Y Gcsh n/a
5 TRCN0000352122 TCTGCCTGAAGTTGGGACAAA pLKO_005 199 3UTR 100% 4.950 2.475 Y Gcsh n/a
6 TRCN0000083397 CAGGACTTGTAAACAAATCTT pLKO.1 333 3UTR 100% 5.625 2.813 Y GCSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06268 pDONR223 100% 32.4% None (many diffs) n/a
2 ccsbBroad304_06268 pLX_304 0% 32.4% V5 (many diffs) n/a
3 TRCN0000471706 TCATGCTTAGTCCCCTTTCGGGCA pLX_317 64.1% 32.4% V5 (many diffs) n/a
Download CSV