Transcript: Human NR_033434.1

Homo sapiens uridine monophosphate synthetase (UMPS), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
UMPS (7372)
Length:
6584
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033434.1
NBCI Gene record:
UMPS (7372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034814 CGTCTTGTAGAAGGAACTATT pLKO.1 271 3UTR 100% 13.200 18.480 N UMPS n/a
2 TRCN0000291987 CGTCTTGTAGAAGGAACTATT pLKO_005 271 3UTR 100% 13.200 18.480 N UMPS n/a
3 TRCN0000034818 CAGTACAATAGCCCACAAGAA pLKO.1 1243 3UTR 100% 4.950 6.930 N UMPS n/a
4 TRCN0000291986 CAGTACAATAGCCCACAAGAA pLKO_005 1243 3UTR 100% 4.950 6.930 N UMPS n/a
5 TRCN0000034816 CAGATGCTTTAGGACCTAGTA pLKO.1 761 3UTR 100% 4.950 3.465 N UMPS n/a
6 TRCN0000291984 CAGATGCTTTAGGACCTAGTA pLKO_005 761 3UTR 100% 4.950 3.465 N UMPS n/a
7 TRCN0000034815 GAAGCGTATTTGAGTAGACTT pLKO.1 1366 3UTR 100% 4.950 3.465 N UMPS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489354 GGCCCGAACCACCTAATGTGCATA pLX_317 27.2% 19.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489048 CATGCCGGTCACCAGTGATATTTG pLX_317 25.8% 19% V5 1_106del;261_262ins154;1393_6584delinsG n/a
3 ccsbBroadEn_01755 pDONR223 100% 19% None 1_106del;261_262ins154;1393_6584del n/a
4 ccsbBroad304_01755 pLX_304 0% 19% V5 1_106del;261_262ins154;1393_6584del n/a
5 TRCN0000466150 GTAATATAACCAAGGGGTTTTTTC pLX_317 25.3% 19% V5 1_106del;261_262ins154;1393_6584del n/a
Download CSV