Transcript: Human NR_033656.1

Homo sapiens syntaxin 8 (STX8), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
STX8 (9482)
Length:
782
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033656.1
NBCI Gene record:
STX8 (9482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380394 ATACGATTCTACTTGTCAAAT pLKO_005 177 3UTR 100% 13.200 18.480 N STX8 n/a
2 TRCN0000059829 CCTCTATCATAAGTCGCCAAA pLKO.1 420 3UTR 100% 4.050 5.670 N STX8 n/a
3 TRCN0000299706 CCTCTATCATAAGTCGCCAAA pLKO_005 420 3UTR 100% 4.050 5.670 N STX8 n/a
4 TRCN0000294842 ATGCCCTTTCCTCTATCATAA pLKO_005 411 3UTR 100% 13.200 10.560 N Stx8 n/a
5 TRCN0000059828 GCCCAAGAAATTGCTGAGAAA pLKO.1 199 3UTR 100% 4.950 3.465 N STX8 n/a
6 TRCN0000059830 GCAGGAAATTGGGAATGAATT pLKO.1 451 3UTR 100% 0.000 0.000 N STX8 n/a
7 TRCN0000299720 GCAGGAAATTGGGAATGAATT pLKO_005 451 3UTR 100% 0.000 0.000 N STX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07425 pDONR223 100% 50.6% None (many diffs) n/a
2 ccsbBroad304_07425 pLX_304 0% 50.6% V5 (many diffs) n/a
3 TRCN0000469685 AATATTCTTTATACGACCAGCCAT pLX_317 64.6% 50.6% V5 (many diffs) n/a
Download CSV