Transcript: Human NR_033697.1

Homo sapiens NADH:ubiquinone oxidoreductase subunit A2 (NDUFA2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NDUFA2 (4695)
Length:
846
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033697.1
NBCI Gene record:
NDUFA2 (4695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026504 GAGAACGTTCTAAGTGGTAAA pLKO.1 596 3UTR 100% 10.800 15.120 N NDUFA2 n/a
2 TRCN0000026485 CGTGAGATTCGCATCCACTTA pLKO.1 251 3UTR 100% 4.950 6.930 N NDUFA2 n/a
3 TRCN0000026487 CCAAGAGACGAATGTCCCTTT pLKO.1 538 3UTR 100% 4.050 2.835 N NDUFA2 n/a
4 TRCN0000026440 CCTTTGAACAACTTCAGTGCT pLKO.1 554 3UTR 100% 2.640 1.848 N NDUFA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13909 pDONR223 100% 34.9% None (many diffs) n/a
2 ccsbBroad304_13909 pLX_304 0% 34.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479908 ACCTGCGGAAAATTATTTTGGATC pLX_317 100% 34.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV