Transcript: Human NR_033701.1

Homo sapiens allograft inflammatory factor 1 like (AIF1L), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-01-13
Taxon:
Homo sapiens (human)
Gene:
AIF1L (83543)
Length:
3477
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033701.1
NBCI Gene record:
AIF1L (83543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005551 CCGAGACTTTGTGAACATGAT pLKO.1 491 3UTR 100% 4.950 6.930 N AIF1L n/a
2 TRCN0000005549 GCACAAATTATCTGCCTTAAA pLKO.1 773 3UTR 100% 13.200 10.560 N AIF1L n/a
3 TRCN0000318809 GCACAAATTATCTGCCTTAAA pLKO_005 773 3UTR 100% 13.200 10.560 N AIF1L n/a
4 TRCN0000005552 CCTCAAGTTAGTCATGATGTT pLKO.1 533 3UTR 100% 4.950 3.465 N AIF1L n/a
5 TRCN0000318808 CCTCAAGTTAGTCATGATGTT pLKO_005 533 3UTR 100% 4.950 3.465 N AIF1L n/a
6 TRCN0000005550 GCGAGATTGACCTGATGTCTT pLKO.1 370 3UTR 100% 4.950 3.465 N AIF1L n/a
7 TRCN0000318743 GCGAGATTGACCTGATGTCTT pLKO_005 370 3UTR 100% 4.950 3.465 N AIF1L n/a
8 TRCN0000005553 CCACCTGGAGATGAAGAAGAT pLKO.1 428 3UTR 100% 4.950 2.970 N AIF1L n/a
9 TRCN0000318744 CCACCTGGAGATGAAGAAGAT pLKO_005 428 3UTR 100% 4.950 2.970 N AIF1L n/a
10 TRCN0000190898 CCTACCGAGACTTTGTGAATA pLKO.1 487 3UTR 100% 13.200 9.240 N Aif1l n/a
11 TRCN0000297662 CCTACCGAGACTTTGTGAATA pLKO_005 487 3UTR 100% 13.200 9.240 N Aif1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489459 AGCAATTTTCTACGCTTTAGGGGC pLX_317 100% 8.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV