Transcript: Human NR_033740.1

Homo sapiens carboxylesterase 1 pseudogene 2 (CES1P2), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
CES1P2 (390732)
Length:
1595
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033740.1
NBCI Gene record:
CES1P2 (390732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049005 AGAACTATTGACCAACCGAAA pLKO.1 165 3UTR 100% 4.050 5.670 N CES1P2 n/a
2 TRCN0000049007 CGGATTTAACAGGAAGGAATT pLKO.1 840 3UTR 100% 0.000 0.000 N CES1P2 n/a
3 TRCN0000049004 CTTCCAACATTGATGAGCTAT pLKO.1 871 3UTR 100% 4.950 3.465 N CES1P2 n/a
4 TRCN0000049003 GCTAACACTGTTGGGTGTGAA pLKO.1 601 3UTR 100% 4.950 3.465 N CES1P2 n/a
5 TRCN0000049006 TGTTCGCATTCCTAAGGAATT pLKO.1 957 3UTR 100% 0.000 0.000 N CES1P2 n/a
6 TRCN0000371770 GAGCTCTTGGAGACGACATTG pLKO_005 673 3UTR 100% 10.800 5.400 Y CES1 n/a
7 TRCN0000371771 TGAAACCCAAGACGGTGATAG pLKO_005 1169 3UTR 100% 10.800 5.400 Y CES1 n/a
8 TRCN0000046936 CCTGCTGACTTGACCAAGAAA pLKO.1 241 3UTR 100% 5.625 2.813 Y CES1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13829 pDONR223 100% 72% None (many diffs) n/a
2 ccsbBroad304_13829 pLX_304 0% 72% V5 (many diffs) n/a
3 TRCN0000476888 TTTCTTTGTTTGGAAACAGATCTG pLX_317 17.2% 72% V5 (many diffs) n/a
Download CSV