Transcript: Human NR_034166.3

Homo sapiens NADH:ubiquinone oxidoreductase subunit A11 (NDUFA11), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NDUFA11 (126328)
Length:
695
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034166.3
NBCI Gene record:
NDUFA11 (126328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034166.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221376 GTTGGACAATACACGTTCACT pLKO.1 368 3UTR 100% 3.000 4.200 N NDUFA11 n/a
2 TRCN0000221373 CGCACGCACAACTACGGGATT pLKO.1 512 3UTR 100% 1.350 1.890 N NDUFA11 n/a
3 TRCN0000417774 GAGTGGCTAAGGTTGGACAAT pLKO_005 357 3UTR 100% 4.950 3.465 N NDUFA11 n/a
4 TRCN0000221372 GCCTACAGAGTCACACTCAAT pLKO.1 314 3UTR 100% 4.950 3.465 N NDUFA11 n/a
5 TRCN0000221374 GCCTGCGTGTACTTTGGCATA pLKO.1 542 3UTR 100% 4.050 2.835 N NDUFA11 n/a
6 TRCN0000221375 CCTTCCTTGAAGGAGTGGCTA pLKO.1 345 3UTR 100% 2.640 1.848 N NDUFA11 n/a
7 TRCN0000417162 ACTCAATCCTCCGGGCACCTT pLKO_005 328 3UTR 100% 0.880 0.616 N NDUFA11 n/a
8 TRCN0000413945 GAACTACTTCCTCGGTGGCTG pLKO_005 466 3UTR 100% 0.720 0.504 N NDUFA11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034166.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04813 pDONR223 100% 60.8% None 1_82del;179_298del;626_695del n/a
2 ccsbBroad304_04813 pLX_304 0% 60.8% V5 1_82del;179_298del;626_695del n/a
3 TRCN0000481006 CCTGGTGTGTGGGCTGCCTCATCG pLX_317 71.7% 60.8% V5 1_82del;179_298del;626_695del n/a
Download CSV