Transcript: Human NR_036440.1

Homo sapiens POU class 5 homeobox 1 pseudogene 3 (POU5F1P3), non-coding RNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
POU5F1P3 (642559)
Length:
1084
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036440.1
NBCI Gene record:
POU5F1P3 (642559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337406 GAGAGGCAACCTGGAGAATTT pLKO_005 722 3UTR 100% 13.200 6.600 Y POU5F1B n/a
2 TRCN0000235525 GAGGATCACCCTGGGATATAC pLKO_005 469 3UTR 100% 13.200 6.600 Y POU5F1 n/a
3 TRCN0000235526 GGCTCTCCCATGCATTCAAAC pLKO_005 1059 3UTR 100% 10.800 5.400 Y POU5F1 n/a
4 TRCN0000004881 CCCTCACTTCACTGCACTGTA pLKO.1 980 3UTR 100% 4.950 2.475 Y POU5F1 n/a
5 TRCN0000235524 AGCGAACCAGTATCGAGAACC pLKO_005 697 3UTR 100% 4.050 2.025 Y POU5F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15533 pDONR223 0% 97.4% None (many diffs) n/a
2 ccsbBroad304_15533 pLX_304 0% 97.4% V5 (many diffs) n/a
3 ccsbBroadEn_06753 pDONR223 100% 97.1% None (many diffs) n/a
4 TRCN0000475990 CATTGATAAATCCGGTTCGTAGAA pLX_317 36.6% 97.1% V5 (many diffs) n/a
5 ccsbBroad304_06753 pLX_304 53.3% 63.4% V5 (many diffs) n/a
Download CSV