Transcript: Human NR_036527.1

Homo sapiens SUGT1P4-STRA6LP-CCDC180 readthrough (SUGT1P4-STRA6LP-CCDC180), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-04-10
Taxon:
Homo sapiens (human)
Gene:
SUGT1P4-STRA6LP-CCDC180 (57653)
Length:
6348
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036527.1
NBCI Gene record:
SUGT1P4-STRA6LP-CCDC180 (57653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131078 GCCTAAATCAATCGGCAGAGT pLKO.1 1386 3UTR 100% 2.640 1.584 N SUGT1P4-STRA6LP-CCDC180 n/a
2 TRCN0000129560 GCAGAGGAGTTCTACCGTAAA pLKO.1 5015 3UTR 100% 10.800 5.400 Y SUGT1P4-STRA6LP-CCDC180 n/a
3 TRCN0000128609 CAACAGCTTCAGAACAAGATA pLKO.1 4361 3UTR 100% 5.625 2.813 Y SUGT1P4-STRA6LP-CCDC180 n/a
4 TRCN0000148630 CCAGGAATCAGTCACTTCAAA pLKO.1 6190 3UTR 100% 5.625 2.813 Y SUGT1P4-STRA6LP-CCDC180 n/a
5 TRCN0000128443 GCATGTGCAGAATTGTAAGAA pLKO.1 2785 3UTR 100% 5.625 2.813 Y SUGT1P4-STRA6LP-CCDC180 n/a
6 TRCN0000146844 CAGCATGATTAGGATGAACAA pLKO.1 5428 3UTR 100% 4.950 2.475 Y SUGT1P4-STRA6LP-CCDC180 n/a
7 TRCN0000148770 CCAGGCAAATAAGTACCACAA pLKO.1 5128 3UTR 100% 4.050 2.025 Y SUGT1P4-STRA6LP-CCDC180 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12386 pDONR223 100% 39.2% None (many diffs) n/a
2 ccsbBroad304_12386 pLX_304 0% 39.2% V5 (many diffs) n/a
Download CSV