Transcript: Human NR_036633.2

Homo sapiens VAMP associated protein B and C (VAPB), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
VAPB (9217)
Length:
7644
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036633.2
NBCI Gene record:
VAPB (9217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381269 GAAACACCAATAGTGTCTAAG pLKO_005 491 3UTR 100% 10.800 8.640 N VAPB n/a
2 TRCN0000381294 TGTTGTCACCACCAACCTAAA pLKO_005 303 3UTR 100% 10.800 8.640 N VAPB n/a
3 TRCN0000152273 CGAAGTTAAGAAGGTTATGGA pLKO.1 538 3UTR 100% 3.000 2.400 N VAPB n/a
4 TRCN0000152239 CCAGTTCTGTTTGACTATGTA pLKO.1 2031 3UTR 100% 5.625 3.938 N VAPB n/a
5 TRCN0000292369 CCAGTTCTGTTTGACTATGTA pLKO_005 2031 3UTR 100% 5.625 3.938 N VAPB n/a
6 TRCN0000152520 GACAGACCGAAATGTGTGTTT pLKO.1 336 3UTR 100% 4.950 3.465 N VAPB n/a
7 TRCN0000292368 GACAGACCGAAATGTGTGTTT pLKO_005 336 3UTR 100% 4.950 3.465 N VAPB n/a
8 TRCN0000153562 GAGAACAAGCAGTTCAAGGAA pLKO.1 602 3UTR 100% 3.000 2.100 N VAPB n/a
9 TRCN0000156377 CCTTGGTACATGATGCTGGAT pLKO.1 1088 3UTR 100% 2.640 1.848 N VAPB n/a
10 TRCN0000153172 GAAGAATGTAAGAGGCTGCAA pLKO.1 557 3UTR 100% 2.640 1.848 N VAPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02110 pDONR223 100% 6.7% None 1_231del;442_443ins185;761_7644del n/a
2 ccsbBroad304_02110 pLX_304 0% 6.7% V5 1_231del;442_443ins185;761_7644del n/a
3 TRCN0000465325 TTTCGGCACTACCTGGTCAGCATA pLX_317 51.1% 6.7% V5 1_231del;442_443ins185;761_7644del n/a
Download CSV