Transcript: Human NR_036680.1

Homo sapiens DPY19L1 pseudogene 1 (DPY19L1P1), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
DPY19L1P1 (100129460)
Length:
1913
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036680.1
NBCI Gene record:
DPY19L1P1 (100129460)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131225 GCCAGCTGGTACTGGATTTAT pLKO.1 273 3UTR 100% 15.000 10.500 N DPY19L1P1 n/a
2 TRCN0000128477 GCACTCTGCATTTCCAATTTA pLKO.1 660 3UTR 100% 15.000 9.000 N DPY19L1P1 n/a
3 TRCN0000131072 CATGGAGAGTGTACCTGTGTA pLKO.1 528 3UTR 100% 4.950 2.970 N DPY19L1P1 n/a
4 TRCN0000129093 GCTTGCTTCTATGTTGCTGTA pLKO.1 399 3UTR 100% 4.050 2.430 N DPY19L1P1 n/a
5 TRCN0000416428 CTTACTCAGATTGCATCATTA pLKO_005 720 3UTR 100% 13.200 6.600 Y Dpy19l1 n/a
6 TRCN0000185907 GTTTGGGAACTCAATGTTATT pLKO.1 836 3UTR 100% 13.200 6.600 Y DPY19L1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1508 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000186231 CTTGTTCTTCAGATGTTGCTA pLKO.1 591 3UTR 100% 3.000 1.500 Y DPY19L1 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1508 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.