Transcript: Human NR_037909.1

Homo sapiens ARHGAP19-SLIT1 readthrough (NMD candidate) (ARHGAP19-SLIT1), long non-coding RNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
ARHGAP19-SLIT1 (100533184)
Length:
1916
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037909.1
NBCI Gene record:
ARHGAP19-SLIT1 (100533184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047241 CCCTCCTCCTAATCGTAATTT pLKO.1 751 3UTR 100% 15.000 7.500 Y ARHGAP19 n/a
2 TRCN0000298661 ATCACAAGGCTCATCGATTTA pLKO_005 239 3UTR 100% 13.200 6.600 Y ARHGAP19 n/a
3 TRCN0000293965 GTTTAGAGTACCGGGTAATAG pLKO_005 469 3UTR 100% 13.200 6.600 Y ARHGAP19 n/a
4 TRCN0000298657 TGTGCGAGATTGCACTATTTG pLKO_005 995 3UTR 100% 13.200 6.600 Y ARHGAP19 n/a
5 TRCN0000047240 CCTTCAGGAGAATATCACAAA pLKO.1 901 3UTR 100% 4.950 2.475 Y ARHGAP19 n/a
6 TRCN0000158608 CGGATCCATAAGAATGACTTT pLKO.1 1546 3UTR 100% 4.950 2.475 Y SLIT1 n/a
7 TRCN0000047242 GAGCTGTTTCAACACGTTCAT pLKO.1 1169 3UTR 100% 4.950 2.475 Y ARHGAP19 n/a
8 TRCN0000286580 GAGCTGTTTCAACACGTTCAT pLKO_005 1169 3UTR 100% 4.950 2.475 Y ARHGAP19 n/a
9 TRCN0000047238 GCTGACACATAAACACTTCAA pLKO.1 619 3UTR 100% 4.950 2.475 Y ARHGAP19 n/a
10 TRCN0000047239 CCATTGGTGAATTGAAGGGAA pLKO.1 1398 3UTR 100% 2.640 1.320 Y ARHGAP19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04462 pDONR223 100% 77% None (many diffs) n/a
2 ccsbBroad304_04462 pLX_304 0% 77% V5 (many diffs) n/a
Download CSV