Transcript: Mouse NR_037920.1

Mus musculus zinc finger protein, autosomal, pseudogene (Zfa-ps), non-coding RNA.

Source:
NCBI, updated 2013-07-17
Taxon:
Mus musculus (mouse)
Gene:
Zfa-ps (22639)
Length:
3420
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037920.1
NBCI Gene record:
Zfa-ps (22639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096497 AGAACGAGATTTCGGCAACAA pLKO.1 2489 3UTR 100% 4.950 6.930 N Zfa-ps n/a
2 TRCN0000096498 TGCCGAAACGAGTCTTGACAA pLKO.1 891 3UTR 100% 4.950 6.930 N Zfa-ps n/a
3 TRCN0000096495 GAACGAGATTTCGGCAACAAA pLKO.1 2490 3UTR 100% 5.625 3.938 N Zfa-ps n/a
4 TRCN0000096496 GCAACAAGTAGAGGACAACAA pLKO.1 1351 3UTR 100% 4.950 3.465 N Zfa-ps n/a
5 TRCN0000096494 CCTGATTCTATACTGAAGTTT pLKO.1 2973 3UTR 100% 5.625 2.813 Y Zfa-ps n/a
6 TRCN0000095622 GCCTATTGAATCGCCATCTTT pLKO.1 1911 3UTR 100% 5.625 2.813 Y Zfx n/a
7 TRCN0000221679 AGTGATTTGAAACGACACATA pLKO.1 2252 3UTR 100% 4.950 2.475 Y ZFX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01791 pDONR223 100% 50.2% None (many diffs) n/a
2 TRCN0000477192 CGGTAAATAATATAGGTCCGTATT pLX_317 20.2% 50.2% V5 (many diffs) n/a
Download CSV