Transcript: Mouse NR_037970.1

Mus musculus bromodomain containing 2 (Brd2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Brd2 (14312)
Length:
4331
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037970.1
NBCI Gene record:
Brd2 (14312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362394 CCCGGAAGCCCTACACTATTA pLKO_005 3487 3UTR 100% 13.200 18.480 N Brd2 n/a
2 TRCN0000362395 CCCTCTCTACGTGATTCAAAT pLKO_005 3375 3UTR 100% 13.200 18.480 N Brd2 n/a
3 TRCN0000362476 GATTACCATGACATCATTAAA pLKO_005 2511 3UTR 100% 15.000 10.500 N Brd2 n/a
4 TRCN0000350530 CTACCACTGTCCTCAACATTC pLKO_005 2059 3UTR 100% 10.800 7.560 N BRD2 n/a
5 TRCN0000023962 CAGCCCAAGAAATCTAAGAAA pLKO.1 3102 3UTR 100% 5.625 3.938 N Brd2 n/a
6 TRCN0000006312 CCTACCACTGTCCTCAACATT pLKO.1 2058 3UTR 100% 5.625 3.938 N BRD2 n/a
7 TRCN0000023961 CCTCAGAATGTATGCAGGATT pLKO.1 1771 3UTR 100% 4.950 3.465 N Brd2 n/a
8 TRCN0000023960 GCTCTGTGGAAGCATCAGTTT pLKO.1 1531 3UTR 100% 4.950 3.465 N Brd2 n/a
9 TRCN0000023963 GCTTATGTTCTCCAACTGCTA pLKO.1 2615 3UTR 100% 2.640 1.848 N Brd2 n/a
10 TRCN0000023959 CCAGAAGAAATTGAGATTGAT pLKO.1 3396 3UTR 100% 5.625 3.375 N Brd2 n/a
11 TRCN0000006311 CCTATGGACATGGGTACTATT pLKO.1 1716 3UTR 100% 13.200 9.240 N BRD2 n/a
12 TRCN0000273643 CCTATGGACATGGGTACTATT pLKO_005 1716 3UTR 100% 13.200 9.240 N BRD2 n/a
13 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 2842 3UTR 100% 4.950 2.475 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488280 TTCTCATGCTTAGATCCGTCTCCC pLX_317 12.2% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV