Transcript: Human NR_038343.2

Homo sapiens MAGI2 antisense RNA 3 (MAGI2-AS3), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
MAGI2-AS3 (100505881)
Length:
8498
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038343.2
NBCI Gene record:
MAGI2-AS3 (100505881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 7346 3UTR 100% 2.160 1.080 Y LOC652276 n/a
2 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 4348 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
3 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 4348 3UTR 100% 1.080 0.540 Y TNNI1 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7551 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000180070 CCTCAGATAATCCACCTGCTT pLKO.1 4324 3UTR 100% 2.640 1.320 Y FAM234B n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7551 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 2.2% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 2.2% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2.2% V5 (many diffs) n/a
Download CSV