Transcript: Human NR_038422.2

Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 1 (PIN1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
PIN1 (5300)
Length:
1191
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038422.2
NBCI Gene record:
PIN1 (5300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010577 GCCATTTGAAGACGCCTCGTT pLKO.1 587 3UTR 100% 2.640 1.848 N PIN1 n/a
2 TRCN0000318417 GCCATTTGAAGACGCCTCGTT pLKO_005 587 3UTR 100% 2.640 1.848 N PIN1 n/a
3 TRCN0000001034 CCAGAAGATCAAGTCGGGAGA pLKO.1 470 3UTR 100% 2.160 1.512 N PIN1 n/a
4 TRCN0000318360 CCAGAAGATCAAGTCGGGAGA pLKO_005 470 3UTR 100% 2.160 1.512 N PIN1 n/a
5 TRCN0000001036 AGGAGAAGATCACCCGGACCA pLKO.1 415 3UTR 100% 0.720 0.504 N PIN1 n/a
6 TRCN0000318359 AGGAGAAGATCACCCGGACCA pLKO_005 415 3UTR 100% 0.720 0.504 N PIN1 n/a
7 TRCN0000001033 CCACCGTCACACAGTATTTAT pLKO.1 783 3UTR 100% 15.000 9.000 N PIN1 n/a
8 TRCN0000318418 CCACCGTCACACAGTATTTAT pLKO_005 783 3UTR 100% 15.000 9.000 N PIN1 n/a
9 TRCN0000001035 AGAAGCCATTTGAAGACGCCT pLKO.1 583 3UTR 100% 0.660 0.396 N PIN1 n/a
10 TRCN0000049211 CGGCTACATCCAGAAGATCAA pLKO.1 461 3UTR 100% 4.950 2.475 Y PIN1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01205 pDONR223 100% 41% None 1_138del;195_247del;681_1191del n/a
2 ccsbBroad304_01205 pLX_304 0% 41% V5 1_138del;195_247del;681_1191del n/a
3 TRCN0000480320 GTTTATTCAGGTGGAAAAAATGGG pLX_317 62.6% 41% V5 1_138del;195_247del;681_1191del n/a
Download CSV