Transcript: Human NR_040080.1

Homo sapiens uncharacterized LOC285150 (FLJ33534), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FLJ33534 (285150)
Length:
1635
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_040080.1
NBCI Gene record:
FLJ33534 (285150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_040080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163249 GATTCAGCTAAATCCTGGGAA pLKO.1 963 3UTR 100% 2.640 3.696 N FLJ33534 n/a
2 TRCN0000166236 CAAACACGATGTGGGAAGTGT pLKO.1 823 3UTR 100% 3.000 2.400 N FLJ33534 n/a
3 TRCN0000163027 GCAGGTCTCGTGGATAATATT pLKO.1 483 3UTR 100% 15.000 10.500 N FLJ33534 n/a
4 TRCN0000164265 CGATGTGGGAAGTGTGTTAAA pLKO.1 829 3UTR 100% 13.200 9.240 N FLJ33534 n/a
5 TRCN0000164226 CCGAATGCATTATGGGAGAAA pLKO.1 462 3UTR 100% 4.950 3.465 N FLJ33534 n/a
6 TRCN0000164725 CGTCACTCTGTGTCATGGAAA pLKO.1 1271 3UTR 100% 4.950 3.465 N FLJ33534 n/a
7 TRCN0000165306 GCCGAATGCATTATGGGAGAA pLKO.1 461 3UTR 100% 4.050 2.835 N FLJ33534 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_040080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13541 pDONR223 100% 19.9% None 1_366del;525C>T;694_1635del n/a
2 ccsbBroad304_13541 pLX_304 0% 19.9% V5 1_366del;525C>T;694_1635del n/a
3 TRCN0000466258 TGGCTGTGACAGCTATGTGAAGCG pLX_317 100% 19.9% V5 1_366del;525C>T;694_1635del n/a
Download CSV