Transcript: Human NR_045022.1

Homo sapiens small nucleolar RNA host gene 29 (SNHG29), transcript variant 25, long non-coding RNA.

Source:
NCBI, updated 2018-10-19
Taxon:
Homo sapiens (human)
Gene:
SNHG29 (125144)
Length:
1067
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045022.1
NBCI Gene record:
SNHG29 (125144)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116034 CCGAGAGAACTGGATTGCGTA pLKO.1 150 3UTR 100% 2.640 3.432 N SNHG29 n/a
2 TRCN0000289954 CCGAGAGAACTGGATTGCGTA pLKO_005 150 3UTR 100% 2.640 3.432 N SNHG29 n/a
3 TRCN0000116033 TGAAGAATCAGCATCATGTTT pLKO.1 293 3UTR 100% 5.625 3.938 N SNHG29 n/a
4 TRCN0000289955 TGAAGAATCAGCATCATGTTT pLKO_005 293 3UTR 100% 5.625 3.938 N SNHG29 n/a
5 TRCN0000116032 GCCATCAGTTTGGATTCTGAA pLKO.1 448 3UTR 100% 4.950 3.465 N SNHG29 n/a
6 TRCN0000289957 GCCATCAGTTTGGATTCTGAA pLKO_005 448 3UTR 100% 4.950 3.465 N SNHG29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10290 pDONR223 100% 20.6% None (many diffs) n/a
2 ccsbBroad304_10290 pLX_304 0% 20.6% V5 (many diffs) n/a
Download CSV