Transcript: Mouse NR_045578.1

Mus musculus suppression of tumorigenicity 7-like (St7l), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
St7l (229681)
Length:
6005
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045578.1
NBCI Gene record:
St7l (229681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377129 GACGGCAAGAGCTGATGTAAA pLKO_005 2602 3UTR 100% 13.200 18.480 N St7l n/a
2 TRCN0000042469 CCAAGTTCTATGTGGCACTTA pLKO.1 1097 3UTR 100% 4.950 6.930 N St7l n/a
3 TRCN0000363602 CCAAGTTCTATGTGGCACTTA pLKO_005 1097 3UTR 100% 4.950 6.930 N St7l n/a
4 TRCN0000038102 GCTCGAATCAAAGCAGCCTAT pLKO.1 1525 3UTR 100% 4.050 5.670 N ST7L n/a
5 TRCN0000377064 TCTACCATGACTGTGTCAAAC pLKO_005 2626 3UTR 100% 10.800 7.560 N St7l n/a
6 TRCN0000042472 CGTCTCTGTCTATCCAAAGAA pLKO.1 2367 3UTR 100% 5.625 3.938 N St7l n/a
7 TRCN0000363603 CGTCTCTGTCTATCCAAAGAA pLKO_005 2367 3UTR 100% 5.625 3.938 N St7l n/a
8 TRCN0000042468 GCCACTTACTTACTATGACAT pLKO.1 1398 3UTR 100% 4.950 3.465 N St7l n/a
9 TRCN0000042470 GCCTATGCTTTCTTTCATCTA pLKO.1 2185 3UTR 100% 4.950 3.465 N St7l n/a
10 TRCN0000327248 GCCTATGCTTTCTTTCATCTA pLKO_005 2185 3UTR 100% 4.950 3.465 N St7l n/a
11 TRCN0000042471 GCTGTGGAATTTAATCCTCAT pLKO.1 2083 3UTR 100% 4.050 2.430 N St7l n/a
12 TRCN0000327276 GCTGTGGAATTTAATCCTCAT pLKO_005 2083 3UTR 100% 4.050 2.430 N St7l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03473 pDONR223 100% 25.4% None (many diffs) n/a
2 ccsbBroad304_03473 pLX_304 0% 25.4% V5 (many diffs) n/a
3 TRCN0000468738 TATGCGGGTTCGGTCTTAGAATAA pLX_317 23.8% 25.4% V5 (many diffs) n/a
Download CSV