Transcript: Human NR_045664.1

Homo sapiens intraflagellar transport 43 (IFT43), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
IFT43 (112752)
Length:
951
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045664.1
NBCI Gene record:
IFT43 (112752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263578 CCTCCCAGCATCCAGATAAAG pLKO_005 315 3UTR 100% 13.200 9.240 N IFT43 n/a
2 TRCN0000282683 AGGCCGAGAATCACCTCAATG pLKO_005 129 3UTR 100% 10.800 7.560 N IFT43 n/a
3 TRCN0000369658 GTACAGGAAGAAGACTTTGTT pLKO_005 279 3UTR 100% 5.625 3.938 N IFT43 n/a
4 TRCN0000168396 GAATCACCTCAATGGCAAGAA pLKO.1 136 3UTR 100% 4.950 3.465 N IFT43 n/a
5 TRCN0000263579 TCACCCATGCTCTAGACATGA pLKO_005 587 3UTR 100% 4.950 3.465 N IFT43 n/a
6 TRCN0000369601 ATGACCTCATGAAGTACTCAG pLKO_005 364 3UTR 100% 4.050 2.835 N IFT43 n/a
7 TRCN0000263577 AGAGACTTCCTCTGCTAAATT pLKO_005 178 3UTR 100% 15.000 9.000 N IFT43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09377 pDONR223 100% 52% None 1_34del;249_250ins95;579_951del n/a
2 ccsbBroad304_09377 pLX_304 0% 52% V5 1_34del;249_250ins95;579_951del n/a
3 TRCN0000472149 CAAACTACACGGGACCCTTGACAT pLX_317 75.4% 52% V5 1_34del;249_250ins95;579_951del n/a
Download CSV