Transcript: Human NR_046177.2

Homo sapiens microtubule associated protein RP/EB family member 2 (MAPRE2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MAPRE2 (10982)
Length:
4317
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046177.2
NBCI Gene record:
MAPRE2 (10982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116508 GCAAGCATCATTTAAGCGAAT pLKO.1 595 3UTR 100% 4.050 5.670 N MAPRE2 n/a
2 TRCN0000116509 CCAGGATAATAACGGGACCAT pLKO.1 184 3UTR 100% 2.640 3.696 N MAPRE2 n/a
3 TRCN0000436968 TTGTTCAGGAGCGGCCTATTG pLKO_005 475 3UTR 100% 10.800 8.640 N MAPRE2 n/a
4 TRCN0000430272 ACTACGATGGGAAGGAGTATG pLKO_005 714 3UTR 100% 10.800 7.560 N MAPRE2 n/a
5 TRCN0000413625 ATGGGTTAATGACATAGTATC pLKO_005 427 3UTR 100% 10.800 7.560 N MAPRE2 n/a
6 TRCN0000337676 ATGTGTATTCTACCTCGATAA pLKO_005 372 3UTR 100% 10.800 7.560 N Mapre2 n/a
7 TRCN0000427262 ATGTGTATTCTACCTCGATAA pLKO_005 372 3UTR 100% 10.800 7.560 N MAPRE2 n/a
8 TRCN0000116511 AGCTTAATGAACAGGTACATT pLKO.1 969 3UTR 100% 5.625 3.938 N MAPRE2 n/a
9 TRCN0000116510 GCATCCAAATCCGATAAAGAT pLKO.1 929 3UTR 100% 5.625 3.938 N MAPRE2 n/a
10 TRCN0000116507 GCTGCTCTTGACACTTCCATT pLKO.1 1226 3UTR 100% 4.950 3.465 N MAPRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02587 pDONR223 100% 22.7% None 1_127del;247_351del;1214_4317del n/a
2 ccsbBroad304_02587 pLX_304 0% 22.7% V5 1_127del;247_351del;1214_4317del n/a
3 TRCN0000467311 AAACTTTGATACGATTGTACTTTT pLX_317 32.8% 22.7% V5 1_127del;247_351del;1214_4317del n/a
Download CSV