Transcript: Human NR_046480.1

Homo sapiens rogdi atypical leucine zipper (ROGDI), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
ROGDI (79641)
Length:
1721
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046480.1
NBCI Gene record:
ROGDI (79641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077953 CCCACCTAACACATTTGCACT pLKO.1 1308 3UTR 100% 2.640 2.112 N ROGDI n/a
2 TRCN0000356592 CAACGCCAGGCTGCTATTTAT pLKO_005 1267 3UTR 100% 15.000 10.500 N ROGDI n/a
3 TRCN0000077956 CCATGTGAGCCAAGCCATTTA pLKO.1 678 3UTR 100% 13.200 9.240 N ROGDI n/a
4 TRCN0000356651 TGATCACCATGGGAATCTTTG pLKO_005 1440 3UTR 100% 10.800 7.560 N ROGDI n/a
5 TRCN0000356654 CCAAGCCATTTACCTGCTTAC pLKO_005 687 3UTR 100% 6.000 4.200 N ROGDI n/a
6 TRCN0000356591 AGGACAAGATCTCCGTGTTCT pLKO_005 1139 3UTR 100% 4.950 3.465 N ROGDI n/a
7 TRCN0000077954 GCTGGTCAACGTCTACATCAA pLKO.1 888 3UTR 100% 4.950 3.465 N ROGDI n/a
8 TRCN0000077957 GCAGCCCAACTCCACCAAGAA pLKO.1 951 3UTR 100% 1.650 1.155 N ROGDI n/a
9 TRCN0000077955 CAACGTCTACATCAACCTCAA pLKO.1 894 3UTR 100% 4.050 2.430 N ROGDI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08941 pDONR223 100% 45.3% None (many diffs) n/a
2 ccsbBroad304_08941 pLX_304 0% 45.3% V5 (many diffs) n/a
3 TRCN0000478692 CTCGTTACAATCCGGCTCGAGTAC pLX_317 42.6% 45.3% V5 (many diffs) n/a
Download CSV