Transcript: Human NR_047683.1

Homo sapiens B cell linker (BLNK), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
BLNK (29760)
Length:
1474
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_047683.1
NBCI Gene record:
BLNK (29760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_047683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359465 TTCGCCAGAGGCGAGTATATA pLKO_005 458 3UTR 100% 15.000 21.000 N BLNK n/a
2 TRCN0000029706 GCGAGTATATAGACAATCGAT pLKO.1 468 3UTR 100% 3.000 4.200 N BLNK n/a
3 TRCN0000029707 CCCATACCTCTGCCAAGATTT pLKO.1 898 3UTR 100% 13.200 9.240 N BLNK n/a
4 TRCN0000329141 TTGAGGATGAGGCTGATTATG pLKO_005 633 3UTR 100% 13.200 9.240 N Blnk n/a
5 TRCN0000029705 CCCGTGGAAGATAATGATGAA pLKO.1 659 3UTR 100% 4.950 3.465 N BLNK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_047683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08117 pDONR223 99.4% 60.5% None (many diffs) n/a
2 ccsbBroad304_08117 pLX_304 10.4% 54.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV